Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249819

Morpholino Name: krt8 MO2
Synonyms: XCK MO-2, XCK1 MO-2
mRNA Target: krt8.1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATGAGACTACGTGAGAAGTTGCTAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTAGCAACTTCTCACGTAGTCTCAT 3' ||||||||||||||||||||||||| 3' CATCGTTGAAGAGTGCATCAGAGTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5732:8521680..8521704 25/25 Antisense target krt8.S
Scaffold90265:921978..922002 21/25 unknown
Publications
First: A mechanoresponsive cadherin-keratin complex directs polarized protrusive behavior and collective cell migration., Dev Cell 2012              
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556