Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249820

Morpholino Name: laptm5 MO1
Synonyms: laptm5
mRNA Target: laptm5

Morpholino Type: uncategorized morpholino
Sequence:
5' TAGGCATCTTAGAATTTGGTGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGACACCAAATTCTAAGATGCCTA 3' ||||||||||||||||||||||||| 3' TACTGTGGTTTAAGATTCTACGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:6156702..6156726 25/25 Antisense target laptm5
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556