Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249820

Morpholino Name: laptm5 MO1
Synonyms: laptm5
mRNA Target: laptm5

Morpholino Type:
Sequence:
5' TAGGCATCTTAGAATTTGGTGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGACACCAAATTCTAAGATGCCTA 3' ||||||||||||||||||||||||| 3' TACTGTGGTTTAAGATTCTACGGAT 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_2:6156702-6156726 25/25 Antisense target laptm5
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning. [Proc Natl Acad Sci U S A 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556