Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249821

Morpholino Name: lbx1 MO1
Synonyms: lbx1 sb
mRNA Target: lbx1

Morpholino Type: splice blocking morpholino
Sequence:
5' GAGTGAGGAACTTACCTTCTGCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25 25/25
genomic

MO
5' GCAGCAGAAGGTAAGTTCCTCACTC 3' ||||||||||||||||||||||||| 3' CGTCGTCTTCCATTCAAGGAGTGAG 5' 5' GCAGCAGAAGGTAAGTTCCTTATCT 3' |||||||||||||||||||| | 3' CGTCGTCTTCCATTCAAGGAGTGAG 5' 5' GCAGCAGAAGGTAAGTTCCTCACTC 3' ||||||||||||||||||||||||| 3' CGTCGTCTTCCATTCAAGGAGTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:19766575..19766599 25/25 Antisense target lbx1.S
chr3L:61342254..61342278 21/25 Antisense off-target cadps2.L
chr7L:24593451..24593475 21/25 Antisense target lbx1.L
chr9_10L:42828913..42828937 21/25 Sense off-target LOC108701198 [provisional:wdr95]
tropicalis 10.0 Chr7:30291514..30291538 25/25 Antisense target lbx1
Chr4:104685897..104685921 21/25 Antisense off-target brdt
Publications
First: A novel role for lbx1 in Xenopus hypaxial myogenesis., Development 2006                                  
Most recent:
View All Papers