Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249821

Morpholino Name: lbx1 MO1
Synonyms: lbx1 sb
mRNA Target: lbx1

Morpholino Type: Splice Blocking()
Sequence:
5' GAGTGAGGAACTTACCTTCTGCTGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 21/25
genomic

MO
5' GCAGCAGAAGGTAAGTTCCTCACTC 3' ||||||||||||||||||||||||| 3' CGTCGTCTTCCATTCAAGGAGTGAG 5' 5' GCAGCAGAAGGTAAGTTCCTTATCT 3' |||||||||||||||||||| | 3' CGTCGTCTTCCATTCAAGGAGTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold1915:90871..90895 25/25 Antisense off-target Xelaev16024187m
Scaffold26505:1647292..1647316 21/25 Antisense off-target Xelaev16035539m
Scaffold33483:1045302..1045326 21/25 Antisense target lbx1.L
Scaffold3490:226652..226676 21/25 Sense off-target Xelaev16045817m
tropicalis 7.1 scaffold_7:24848993..24849017 25/25 Antisense target lbx1
scaffold_4:67580168..67580192 21/25 Antisense off-target brdt
Publications
First: A novel role for lbx1 in Xenopus hypaxial myogenesis. [Development 2006]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556