Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249822

Morpholino Name: lbx1 MO2
Synonyms: lbx1 atg, lbx1 tb
mRNA Target: lbx1

Morpholino Type: Translation Blocking()
Sequence:
5' TCATCTTTGGAAGTCATAGTGGGAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' AGTCCACCATGACTTCCAAAGATGA 3' |||| ||||||||||||||||| 3' CAGGGTGATACTGAAGGTTTCTACT 5' 5' GTCCCACTATGACTTCCAAAGATGA 3' ||||||||||||||||||||||||| 3' CAGGGTGATACTGAAGGTTTCTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold33483:1044979-1045003 25/25 Antisense target lbx1.L
Scaffold169907:1795203-1795227 21/25 unknown
Scaffold245292:100034-100058 21/25 unknown
Scaffold77019:155420-155444 21/25 unknown
Scaffold9994:11492621-11492645 21/25 Sense off-target Xelaev16081500m
tropicalis 7.1 scaffold_9:28776449-28776473 22/25 Sense off-target aox1
scaffold_2:136233874-136233898 21/25 unknown
scaffold_6:60117609-60117633 21/25 Antisense off-target elovl2
scaffold_7:24849316-24849340 21/25 Antisense target lbx1
Publications
First: A novel role for lbx1 in Xenopus hypaxial myogenesis. [Development 2006]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556