Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249823

Morpholino Name: lef1 MO1
Synonyms: XtLef-1, lef1
mRNA Target: lef1

Morpholino Type:
Sequence:
5' CCTGCTCCAGAGAGCTGAGGCATGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CCATGCCTCAGCTCTCTGGAGCAGG 3' ||||||||||||||||||||||||| 3' GGTACGGAGTCGAGAGACCTCGTCC 5' 5' CCATGCCTCAGCTCTCTGGAGCAGG 3' ||||||||||||||||||||||||| 3' GGTACGGAGTCGAGAGACCTCGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold81573:156365-156389 25/25 Antisense off-target Xelaev16074861m
Scaffold88765:3477796-3477820 25/25 Antisense target lef1.L
Scaffold7555:8837091-8837115 22/25 unknown
Scaffold55171:1119499-1119523 21/25 Sense off-target Xelaev16062243m
tropicalis 7.1 scaffold_1:155868713-155868737 25/25 Antisense target lef1
Publications
First: Lef-1 and Tcf-3 transcription factors mediate tissue-specific Wnt signaling during Xenopus development. [Curr Biol 2002]
Most recent: Lef1 plays a role in patterning the mesoderm and ectoderm in Xenopus tropicalis. [Int J Dev Biol 2009]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556