Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249824

Morpholino Name: lef1 MO2
Synonyms: Lef1 MO, lef1
mRNA Target: lef1

Morpholino Type:
Sequence:
5' CTCCAGAGAGCTGAGGCATGGCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GGAGCCATGCCTCAGCTCTCTGGAG 3' ||||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5' 5' AGAGCCATGCCTCAGCTCTCTGGAG 3' |||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold81573:156369-156393 25/25 Antisense off-target Xelaev16074861m
Scaffold88765:3477800-3477824 24/25 Antisense target lef1.L
Scaffold7555:8837087-8837111 21/25 unknown
tropicalis 7.1 scaffold_1:155868717-155868741 25/25 Antisense target lef1
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development. [Development 2005]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556