Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249824

Morpholino Name: lef1 MO2
Synonyms: Lef1 MO, lef1
mRNA Target: lef1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCAGAGAGCTGAGGCATGGCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' GGAGCCATGCCTCAGCTCTCTGGAG 3' ||||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5' 5' AGAGCCATGCCTCAGCTCTCTGGAG 3' |||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5' 5' GGAGCCATGCCTCAGCTCTCTGGAG 3' ||||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:54965885..54965909 25/25 Antisense target lef1.S
chr1L:59981147..59981171 24/25 Antisense target lef1.L
chr7L:14685043..14685067 21/25 unknown
tropicalis 10.0 Chr1:67039968..67039992 25/25 Antisense target lef1
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development., Development 2005            
Most recent:
View All Papers