Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249824

Morpholino Name: lef1 MO2
Synonyms: Lef1 MO, lef1
mRNA Target: lef1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTCCAGAGAGCTGAGGCATGGCTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' GGAGCCATGCCTCAGCTCTCTGGAG 3' ||||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5' 5' AGAGCCATGCCTCAGCTCTCTGGAG 3' |||||||||||||||||||||||| 3' CCTCGGTACGGAGTCGAGAGACCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold81573:156369..156393 25/25 Antisense off-target Xelaev16074861m
Scaffold88765:3477800..3477824 24/25 Antisense target lef1.L
Scaffold7555:8837087..8837111 21/25 unknown
tropicalis 7.1 scaffold_1:155868717..155868741 25/25 Antisense target lef1
Publications
First: Distinct roles for Xenopus Tcf/Lef genes in mediating specific responses to Wnt/beta-catenin signalling in mesoderm development., Development 2005            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556