Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249825

Morpholino Name: lef1 MO3
Synonyms: lefMO1
mRNA Target: lef1

Morpholino Type: uncategorized morpholino
Sequence:
5' TACGGAGTCGAGAGACCTCGTCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Cold-inducible RNA binding protein (CIRP), a novel XTcf-3 specific target gene regulates neural development in Xenopus., BMC Dev Biol 2008                                  
Most recent: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556