Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249826

Morpholino Name: lef1 MO4
Synonyms: lefMo2
mRNA Target: lef1

Morpholino Type:
Sequence:
5' CAAGACCTCGGTACGGAGTCGAGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
Publications
First: Cold-inducible RNA binding protein (CIRP), a novel XTcf-3 specific target gene regulates neural development in Xenopus. [BMC Dev Biol 2008]
Most recent: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain. [Dev Biol 2010]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556