Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249828

Morpholino Name: lefty MO2
Synonyms: Xlefty-MO2, XleftyB-MO
mRNA Target: lefty

Morpholino Type:
Sequence:
5' GATGTGACACAGGGTGCAAGTGCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold149890:1467522-1467546 21/25 Antisense off-target Xelaev16014676m
Scaffold287959:527593-527617 21/25 unknown
tropicalis 7.1 scaffold_2:78534891-78534915 22/25 Antisense off-target spats2
scaffold_4:75197548-75197572 21/25 unknown
scaffold_6:105727509-105727533 21/25 unknown
scaffold_6:45203508-45203532 21/25 unknown
scaffold_9:96777978-96778002 21/25 unknown
Publications
First: Lefty-dependent inhibition of Nodal- and Wnt-responsive organizer gene expression is essential for normal gastrulation. [Curr Biol 2002]
Most recent: Cooperative non-cell and cell autonomous regulation of Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus. [Dev Biol 2006]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556