Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249829

Morpholino Name: lefty MO3
Synonyms: Xantivin (XatvMO)
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' AAAGATTTGGTAGTGACACCCATTC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAATGGGTGTCACTACCAAATCTTT 3' ||||||||||||||||||||||||| 3' CTTACCCACAGTGATGGTTTAGAAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:5086489..5086513 25/25 Antisense target lefty.L
Scaffold107958:579930..579954 21/25 Sense off-target Xelaev16002115m
Scaffold13471:4283488..4283512 21/25 unknown
Publications
First: Xantivin suppresses the activity of EGF-CFC genes to regulate nodal signaling., Int J Dev Biol 2004            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556