Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249830

Morpholino Name: lefty MO4
Synonyms: XatvMO1
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' ACCCATTCTGATGTGACAGTCTACA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTAGACTGTCACATCAGAATGGGT 3' ||||||||||||||||||||||||| 3' ACATCTGACAGTGTAGTCTTACCCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:17171223..17171247 25/25 Antisense target lefty.L
chr9_10L:18074576..18074600 21/25 Sense off-target tpd52l2.L
tropicalis 10.0 Chr2:129457190..129457214 21/25 unknown
Chr3:35559973..35559997 21/25 unknown
Publications
First: Cooperative non-cell and cell autonomous regulation of Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus., Dev Biol 2006                          
Most recent:
View All Papers