Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249831

Morpholino Name: lefty MO5
Synonyms: Lefty Target Protector morpholino
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTGCTTCTCTAAATGCTTCTATCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' CGATAGAAGCATTTAGAGAAGCACT 3' |||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5' 5' TGATAGAAGCATTTAGAGAAGCACT 3' ||||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5' 5' TGATAGAAGCATTTAGAGAAGCACT 3' ||||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold102974:5089300..5089324 25/25 Antisense target lefty.L
Scaffold27161:6673647..6673671 25/25 Antisense target lefty.S
Scaffold52702:9291135..9291159 22/25 unknown
Scaffold120240:688586..688610 21/25 unknown
Scaffold15893:5583665..5583689 21/25 Antisense off-target Xelaev16016852m
Scaffold179377:336692..336716 21/25 unknown
Scaffold20345:4171280..4171304 21/25 Sense off-target Xelaev16026262m
Scaffold5732:4043116..4043140 21/25 Antisense off-target Xelaev16063093m
Scaffold6590:4435213..4435237 21/25 Sense off-target Xelaev16067467m
tropicalis 7.1 scaffold_5:117929362..117929386 24/25 Antisense target lefty
scaffold_3b:2051327..2051351 21/25 unknown
scaffold_5:82867970..82867994 21/25 unknown
Publications
First: The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection., Dev Cell 2009      
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556