Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249831

Morpholino Name: lefty MO5
Synonyms: Lefty Target Protector morpholino
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTGCTTCTCTAAATGCTTCTATCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' CGATAGAAGCATTTAGAGAAGCACT 3' |||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5' 5' TGATAGAAGCATTTAGAGAAGCACT 3' ||||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5' 5' TGATAGAAGCATTTAGAGAAGCACT 3' ||||||||||||||||||||||||| 3' ACTATCTTCGTAAATCTCTTCGTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:17168395..17168419 25/25 Antisense target lefty.L
chr5S:12270774..12270798 25/25 Antisense target lefty.S
chr5S:79581758..79581782 22/25 Antisense off-target LOC108717438 [provisional:csmd1]
chr2L:12922752..12922776 21/25 Sense off-target runx1.L
chr2S:125910230..125910254 21/25 Antisense off-target LOC108709000 [provisional:dip2b]
chr3L:14624848..14624872 21/25 Antisense off-target rnf130.L
chr3L:24990171..24990195 21/25 Sense off-target LOC108710910
chr9_10L:87105389..87105413 21/25 unknown
chr9_10S:71552620..71552644 21/25 Sense off-target satb2.S
tropicalis 10.0 Chr5:8261327..8261351 24/25 Antisense target lefty
Chr3:148938982..148939006 21/25 unknown
Chr5:45629311..45629335 21/25 Antisense off-target utrn
Publications
First: The miR-430/427/302 family controls mesendodermal fate specification via species-specific target selection., Dev Cell 2009      
Most recent:
View All Papers