Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249832

Morpholino Name: lefty MO6
Synonyms: XatvMO2
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGACTTGAAATACCTGCATTGCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 7.1 scaffold_3:70883793..70883817 21/25 unknown
Publications
First: Cooperative non-cell and cell autonomous regulation of Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus., Dev Biol 2006                          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556