Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249832

Morpholino Name: lefty MO6
Synonyms: XatvMO2
mRNA Target: lefty

Morpholino Type: uncategorized morpholino
Sequence:
5' AGGACTTGAAATACCTGCATTGCCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' TGGCAATGCAGGTATGCCGAGTCCT 3' |||||||||||||| | |||||| 3' CCCGTTACGTCCATAAAGTTCAGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
tropicalis 10.0 Chr3:42411259..42411283 21/25 unknown
Chr5:8258128..8258152 21/25 Antisense target lefty
Publications
First: Cooperative non-cell and cell autonomous regulation of Nodal gene expression and signaling by Lefty/Antivin and Brachyury in Xenopus., Dev Biol 2006                          
Most recent:
View All Papers