Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249833

Morpholino Name: lemd3 MO1
Synonyms: MO-XMAN1, XMAN1, XMAN1-MO
mRNA Target: lemd3

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCGCCATTTTGACCACTCGGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/22 22/22
genomic

MO
5' ACCGAGTGGTCAAAATGGCGAC 3' |||||||||||||||||||| | 3' TGGCTCACCAGTTTTACCGCCG 5' 5' ACCGAGTGGTCAAAATGGCGGC 3' |||||||||||||||||||||| 3' TGGCTCACCAGTTTTACCGCCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold5925:611821..611842 22/22 Antisense target lemd3.S
Scaffold140447:586368..586389 18/22 Sense off-target Xelaev16012553m
tropicalis 7.1 scaffold_3:86347995..86348016 21/22 Antisense target lemd3
scaffold_6:110852404..110852425 18/22 unknown
scaffold_6:112761393..112761414 18/22 unknown
scaffold_7:24400270..24400291 18/22 unknown
Publications
First: XMAN1, an inner nuclear membrane protein, antagonizes BMP signaling by interacting with Smad1 in Xenopus embryos., Development 2003              
Most recent: Essential roles of LEM-domain protein MAN1 during organogenesis in Xenopus laevis and overlapping functions of emerin., Eur J Cell Biol 2013  
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556