Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249837

Morpholino Name: lgr4 MO2
Synonyms:
Target mRNA: lgr4

Morpholino Type: uncategorized morpholino
Sequence: 5' CACAACCTGCACTTTATTTGGCCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCGGCCAAATAAAGTGCAGGTTGTG 3' ||||||||||||||||||||||||| 3' CGCCGGTTTATTTCACGTCCAACAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:108077507..108077531 21/25 Antisense off-target tsc2.L
tropicalis 10.0 Chr4:21077379..21077403 25/25 Antisense target lgr4
Chr8:1370807..1370831 21/25 Sense off-target cfp
Publications
First: LGR4 and LGR5 are R-spondin receptors mediating Wnt/β-catenin and Wnt/PCP signalling., EMBO Rep 2011  
Most recent:
View All Papers