Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249842

Morpholino Name: lhx1 MO1
Synonyms: Lim1-MO, Xlim-1 MO
mRNA Target: lhx1

Morpholino Type: uncategorized morpholino
Sequence:
5' GACACTGTGGTCTAGAAAGACAAGA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GCTTGTCTTTCTGGACCATAGTGTC 3' ||||||||||| ||||| |||||| 3' AGAACAGAAAGATCTGGTGTCACAG 5' 5' TCTTGTCTTTCTAGACCACAGTGTC 3' ||||||||||||||||||||||||| 3' AGAACAGAAAGATCTGGTGTCACAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:61067322..61067346 25/25 Antisense target lhx1.L
chr1L:35699570..35699594 22/25 unknown
tropicalis 10.0 Chr2:75675287..75675311 22/25 Antisense target lhx1
Chr8:53144410..53144434 21/25 unknown
Publications
First: Wnt-5A/Ror2 regulate expression of XPAPC through an alternative noncanonical signaling pathway., Dev Cell 2007      
Most recent: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
View All Papers