Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249846

Morpholino Name: lin28a MO2
Synonyms: lin28a2 MO
mRNA Target: lin28a

Morpholino Type: uncategorized morpholino
Sequence:
5' GAGTCTCTTCTATCTGAGGTCAGGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 22/25
genomic

MO
5' GCCTGACCTCAGATAGAAGAGACTT 3' |||||||||||||||||||||||| 3' CGGACTGGAGTCTATCTTCTCTGAG 5' 5' GTCTGACCACAGATAGAAGAGACTT 3' | |||||| ||||||||||||||| 3' CGGACTGGAGTCTATCTTCTCTGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8834:1139813..1139837 23/25 unknown
Scaffold27891:132128..132152 22/25 Antisense target lin28a.S
Scaffold41523:629108..629132 21/25 unknown
tropicalis 7.1 scaffold_2:457718..457742 24/25 Antisense target lin28a
Publications
First: Lin28 proteins are required for germ layer specification in Xenopus., Development 2013                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556