Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249847

Morpholino Name: lin28b MO1
Synonyms: lin28b MO
mRNA Target: lin28b

Morpholino Type: uncategorized morpholino
Sequence:
5' TCCTTCGGCCATGATGCCTCCTGCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 23/25
genomic

MO
5' AGCAGGAGGCATCATGGCCGAAGGT 3' |||||||||||||||||||||||| 3' TCGTCCTCCGTAGTACCGGCTTCCT 5' 5' AGCAGGAGGCGTCATGGCCGAAGGT 3' |||||||||| ||||||||||||| 3' TCGTCCTCCGTAGTACCGGCTTCCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold8355:2431663..2431687 23/25 Antisense target lin28b.S
Scaffold8630:3161804..3161828 23/25 Antisense off-target Xelaev16076431m
tropicalis 7.1 scaffold_5:47582710..47582734 24/25 Antisense target lin28b
Publications
First: Lin28 proteins are required for germ layer specification in Xenopus., Development 2013                        
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556