Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249850

Morpholino Name: lmnb2 MO1
Synonyms: LB2MO
mRNA Target: lmnb2

Morpholino Type: uncategorized morpholino
Sequence:
5' ACCGACTTGGTGTAGCAGTAGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' ATGGCTACTGCTACACCAAGCCGTT 3' |||||||||||||||||||| || | 3' TACCGATGACGATGTGGTTCAGCCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold181141:977063..977087 25/25 Antisense off-target Xelaev16022050m
tropicalis 7.1 scaffold_1:135734712..135734736 23/25 Antisense target lmnb2
Publications
First: Local translation of extranuclear lamin B promotes axon maintenance., Cell 2012                                
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556