Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249852

Morpholino Name: lmx1b.1 MO1
Synonyms: xLmx1b-MO
Target mRNA: lmx1b.1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCATGCCACTCTCCAAAACTCAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTGAGTTTTGGAGAGTGGCATGGAT 3' ||||||||||||||||||||||||| 3' CACTCAAAACCTCTCACCGTACCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:38661015..38661039 25/25 Antisense target lmx1b.1.S
chr1L:71385660..71385684 21/25 Antisense off-target grid2.L
chr1S:21030728..21030752 21/25 unknown
tropicalis 10.0 Chr1:22109794..22109818 21/25 Antisense off-target mfsd10
Chr1:204377913..204377937 21/25 unknown
Chr9:7517186..7517210 21/25 unknown
Publications
First: Activity-dependent expression of Lmx1b regulates specification of serotonergic neurons modulating swimming behavior., Neuron 2010  
Most recent:
View All Papers