Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249853

Morpholino Name: lmx1b.1 MO2
Synonyms: lmx1b morpholino 2, lmx1b-MO2
mRNA Target: lmx1b.1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCCACTCTCCAAAACTCACTTCAGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACTGAAGTGAGTTTTGGAGAGTGGC 3' ||||||||||||||||||||||||| 3' TGACTTCACTCAAAACCTCTCACCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:38661021..38661045 25/25 Antisense target lmx1b.1.S
chr4L:57875272..57875296 21/25 Antisense off-target cep89.L
chr9_10L:5659338..5659362 21/25 Antisense off-target LOC108701983 [provisional:c1ql1]
tropicalis 10.0 Chr7:73180257..73180281 21/25 unknown
Publications
First: The lmx1b gene is pivotal in glomus development in Xenopus laevis., Dev Biol 2008            
Most recent: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
View All Papers