Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249854

Morpholino Name: lmx1b.1 MO3
Synonyms: lmx1b morpholino 1
Target mRNA: lmx1b.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCAATATCCATGCCACTCTCCAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GCTGGAGAGGGGCATGGATATTGCA 3' ||||||| ||||||||||||||| 3' AAACCTCTCACCGTACCTATAACGT 5' 5' TTTGGAGAGTGGCATGGATATTGCA 3' ||||||||||||||||||||||||| 3' AAACCTCTCACCGTACCTATAACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:38661009..38661033 25/25 Antisense target lmx1b.1.S
chr8L:11696800..11696824 22/25 Antisense target lmx1b.1.L
chr8L:11696800..11696824 22/25 Sense off-target Xelaev18038461m
chr5L:5780427..5780451 21/25 unknown
chr7S:7336134..7336158 21/25 unknown
tropicalis 10.0 Chr1:185876761..185876785 21/25 Antisense off-target dmgdh
Publications
First: The lmx1b gene is pivotal in glomus development in Xenopus laevis., Dev Biol 2008            
Most recent:
View All Papers