Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249855

Morpholino Name: lmx1b.1 MO4
Synonyms: lmx1b-MO
Target mRNA: lmx1b.1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGACCTGTTGCAATATCCATGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGCATGGATATTGCAACAGGTCCCG 3' ||||||||||||||||||||||||| 3' CCGTACCTATAACGTTGTCCAGGGC 5' 5' GGCATGGATATTGCAACAGGTCCCG 3' ||||||||||||||||||||||||| 3' CCGTACCTATAACGTTGTCCAGGGC 5' 5' GGCATGGATATTGCAACAGGTCCCG 3' ||||||||||||||||||||||||| 3' CCGTACCTATAACGTTGTCCAGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:11696810..11696834 25/25 Antisense target lmx1b.1.L
chr8S:38660999..38661023 25/25 Antisense target lmx1b.1.S
chr8L:11696810..11696834 25/25 Sense off-target Xelaev18038461m
tropicalis 10.0 Chr8:27013798..27013822 25/25 Antisense target lmx1b.1
Publications
First: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
Most recent:
View All Papers