Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249860

Morpholino Name: lrp6 MO1
Synonyms: LRP6 MO, LRP6MO, lrp6
mRNA Target: lrp6

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCCGGCTTCTCCGCTCCGACCCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' AGGGGTCGGAGCGGAGAAGCCGGGG 3' ||||||||||||||||||||||||| 3' TCCCCAGCCTCGCCTCTTCGGCCCC 5' 5' AGGGGTCGGAGCGGAGAAGCCGGGG 3' ||||||||||||||||||||||||| 3' TCCCCAGCCTCGCCTCTTCGGCCCC 5' 5' AGGGGTCGGAGCGTAGAAGCCGGGG 3' ||||||||||||| ||||||||||| 3' TCCCCAGCCTCGCCTCTTCGGCCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold31:2394167..2394191 25/25 Antisense target lrp6.L
Scaffold16589:213..237 24/25 Antisense target lrp6.S
Scaffold16589:213..237 24/25 Sense off-target Xelaev18000437m
tropicalis 10.0 Chr3:8275445..8275469 25/25 Antisense target lrp6
Publications
First: Kremen is required for neural crest induction in Xenopus and promotes LRP6-mediated Wnt signaling., Development 2007        
Most recent: The tumor suppressor PTPRK promotes ZNRF3 internalization and is required for Wnt inhibition in the Spemann organizer., Elife 2020                                                                                                
View All Papers