Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249860

Morpholino Name: lrp6 MO1
Synonyms: LRP6 MO, LRP6MO, lrp6
mRNA Target: lrp6

Morpholino Type: uncategorized morpholino
Sequence:
5' CCCCGGCTTCTCCGCTCCGACCCCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGGGGTCGGAGCGGAGAAGCCGGGG 3' ||||||||||||||||||||||||| 3' TCCCCAGCCTCGCCTCTTCGGCCCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold388571:201252..201276 25/25 Antisense target lrp6.S
Scaffold266951:213..237 24/25 Sense off-target Xelaev16035834m
Publications
First: Kremen is required for neural crest induction in Xenopus and promotes LRP6-mediated Wnt signaling., Development 2007        
Most recent: Dkk2 promotes neural crest specification by activating Wnt/β-catenin signaling in a GSK3β independent manner., Elife 2018                        
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556