Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249864

Morpholino Name: mab21l3 MO1
Synonyms: Xmab21l3 MO
Target mRNA: mab21l3

Morpholino Type: uncategorized morpholino
Sequence: 5' CATCCTCAGCCTTCACTCCCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGAAGGGAGTAACGGCTGAGGATG 3' ||||||||||| | ||||||||||| 3' TACTTCCCTCACTTCCGACTCCTAC 5' 5' ATGAAGGGAGTGAAGGCTGAGGATG 3' ||||||||||||||||||||||||| 3' TACTTCCCTCACTTCCGACTCCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:28972505..28972529 25/25 Antisense target mab21l3.S
chr5L:137396610..137396634 21/25 Antisense off-target asap2.L
tropicalis 10.0 Chr2:1124523..1124547 23/25 Antisense target mab21l3
Publications
First: Xmab21l3 mediates dorsoventral patterning in Xenopus laevis., Mech Dev 2012                        
Most recent:
View All Papers