Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249865

Morpholino Name: mafb MO1
Synonyms: mafb-MO
mRNA Target: mafb

Morpholino Type:
Sequence:
5' AATGGGCAACTCTCCAGCCATACTG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' CAGTATGGCTGGAGAGTTGTCTATT 3' ||||||||||||||||||| | ||| 3' GTCATACCGACCTCTCAACGGGTAA 5' 5' CAGTATGGCTGGAGAGTTGCCCATT 3' ||||||||||||||||||||||||| 3' GTCATACCGACCTCTCAACGGGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold4704:1062225..1062249 25/25 Antisense target mafb.S
Scaffold45834:856488..856512 24/25 Antisense off-target Xelaev16055539m
Scaffold124774:1425318..1425342 22/25 Antisense off-target Xelaev16006839m
Scaffold15415:2789477..2789501 21/25 Sense off-target lipe.L
tropicalis 7.1 scaffold_10:8561933..8561957 23/25 Antisense target mafb
scaffold_7:20046821..20046845 21/25 Antisense off-target NFU1
Publications
First: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus. [Development 2010]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556