Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249865

Morpholino Name: mafb MO1
Synonyms: mafb-MO
Target mRNA: mafb

Morpholino Type: uncategorized morpholino
Sequence: 5' AATGGGCAACTCTCCAGCCATACTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genomic

MO
5' CAGTATGGCTGGAGAGTTGTCTATT 3' ||||||||||||||||||| | ||| 3' GTCATACCGACCTCTCAACGGGTAA 5' 5' CAGTATGGCTGGAGAGTTGTCCATT 3' ||||||||||||||||||| ||||| 3' GTCATACCGACCTCTCAACGGGTAA 5' 5' CAGTATGGCTGGAGAGTTGCCCATT 3' ||||||||||||||||||||||||| 3' GTCATACCGACCTCTCAACGGGTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:29530841..29530865 25/25 Antisense target mafb.S
chr9_10L:32148501..32148525 24/25 Antisense target mafb.L
chr5S:70059716..70059740 22/25 Antisense off-target tbx18.S
chr7L:102680123..102680147 21/25 Sense off-target lipe.L
tropicalis 10.0 Chr10:40805877..40805901 23/25 Antisense target mafb
Chr3:122573328..122573352 21/25 Antisense off-target nfu1
Publications
First: Notch signaling, wt1 and foxc2 are key regulators of the podocyte gene regulatory network in Xenopus., Development 2010                              
Most recent:
View All Papers