Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249866

Morpholino Name: magoh MO1
Synonyms: 26A10.2moA
Target mRNA: magoh

Morpholino Type: uncategorized morpholino
Sequence: 5' GTAGAAGTCGCTCCCCATGTTACCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 23/25
genomic

MO
5' CGGTAACATGGGGAGCGACTTCTAC 3' ||||||||||||||||||||||||| 3' GCCATTGTACCCCTCGCTGAAGATG 5' 5' CGGTAACATGGGGAGCGATTTCTAT 3' |||||||||||||||||| ||||| 3' GCCATTGTACCCCTCGCTGAAGATG 5' 5' CGGTAACATGGGGAGCGATTTCTAT 3' |||||||||||||||||| ||||| 3' GCCATTGTACCCCTCGCTGAAGATG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:87188658..87188682 23/25 Antisense target magoh.L
chr4S:70918363..70918387 23/25 Antisense target magoh.S
chr7L:58302462..58302486 21/25 Antisense off-target casz1.L
tropicalis 10.0 Chr4:97133088..97133112 25/25 Antisense target magoh
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers