Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249868

Morpholino Name: magoh MO3
Synonyms: MagohMO
Target mRNA: magoh

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCGGAGATAGAAATCGCTCCCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genomic

MO
5' CATGGGGAGCGACTTCTACCTCCGC 3' |||||||||||| ||||| |||||| 3' GTACCCCTCGCTAAAGATAGAGGCG 5' 5' CATGGGGAGCGATTTCTATCTCCGC 3' ||||||||||||||||||||||||| 3' GTACCCCTCGCTAAAGATAGAGGCG 5' 5' CATGGGGAGCGATTTCTATCTCCGG 3' |||||||||||||||||||||||| 3' GTACCCCTCGCTAAAGATAGAGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:87188652..87188676 25/25 Antisense target magoh.L
chr4S:70918357..70918381 24/25 Antisense target magoh.S
tropicalis 10.0 Chr4:97133082..97133106 23/25 Antisense target magoh
Publications
First: Regulation of vertebrate embryogenesis by the exon junction complex core component Eif4a3., Dev Dyn 2010                
Most recent:
View All Papers