Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249869

Morpholino Name: map2k5 MO1
Synonyms: MEK5 MO
Target mRNA: map2k5

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGGCCGAAGCCAAATAACAGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GATGCTGTTATTTGGCTTCGGCCTG 3' ||||||||||||||||||||||||| 3' CTACGACAATAAACCGAAGCCGGAC 5' 5' GATGCTGTTATTTGGCTTCGGCCTG 3' ||||||||||||||||||||||||| 3' CTACGACAATAAACCGAAGCCGGAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:108743281..108743305 25/25 Antisense target map2k5.L
tropicalis 10.0 Chr3:117517594..117517618 25/25 Antisense target map2k5
Publications
First: Requirement of the MEK5-ERK5 pathway for neural differentiation in Xenopus embryonic development., EMBO Rep 2005  
Most recent:
View All Papers