Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249870

Morpholino Name: map3k7 MO1
Synonyms: tak1 MO, xTAK1
mRNA Target: map3k7

Morpholino Type:
Sequence:
5' TCATTTCAGCAGAGGTGGCAGACAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGTCTGCCACCTCTGCTGAAATGA 3' ||||||||||||||||||||||||| 3' TACAGACGGTGGAGACGACTTTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold22185:1229564..1229588 25/25 Antisense target map3k7.L
Scaffold131887:764641..764665 23/25 Antisense off-target Xelaev16008919m
Scaffold104417:3646465..3646489 22/25 Sense off-target Xelaev16001210m
Scaffold152864:214..238 22/25 unknown
Scaffold232882:2140607..2140631 22/25 Sense off-target Xelaev16030544m
Scaffold4431:414822..414846 22/25 unknown
Scaffold678:1494788..1494812 22/25 unknown
Scaffold102262:910068..910092 21/25 Sense off-target Xelaev16000390m
Scaffold102277:908359..908383 21/25 unknown
Scaffold107353:33355..33379 21/25 unknown
Scaffold111824:274580..274604 21/25 unknown
Scaffold112554:3228431..3228455 21/25 unknown
Scaffold115163:1521326..1521350 21/25 unknown
Scaffold12518:15318242..15318266 21/25 Antisense off-target Xelaev16007449m
Scaffold133669:782560..782584 21/25 unknown
Scaffold13576:4355844..4355868 21/25 unknown
Scaffold1391:1511550..1511574 21/25 unknown
Scaffold170143:1043..1067 21/25 unknown
Scaffold178054:75..99 21/25 unknown
Scaffold198766:158..182 21/25 unknown
Scaffold213094:100..124 21/25 unknown
Scaffold221007:4634088..4634112 21/25 unknown
Scaffold23301:2513172..2513196 21/25 unknown
Scaffold23872:375328..375352 21/25 Antisense off-target Xelaev16031701m
Scaffold250769:155230..155254 21/25 unknown
Scaffold271178:1050340..1050364 21/25 Antisense off-target Xelaev16036941m
Scaffold277796:90..114 21/25 unknown
Scaffold300618:102..126 21/25 unknown
Scaffold30711:958928..958952 21/25 unknown
Scaffold31653:4993070..4993094 21/25 unknown
Scaffold34423:1460065..1460089 21/25 Sense off-target Xelaev16044979m
Scaffold34527:8468869..8468893 21/25 Antisense off-target Xelaev16045411m
Scaffold3467:541587..541611 21/25 unknown
Scaffold351606:440497..440521 21/25 Sense off-target Xelaev16046072m
Scaffold367808:29288..29312 21/25 Sense off-target Xelaev16047775m
Scaffold3715:229..253 21/25 unknown
Scaffold376747:87..111 21/25 unknown
Scaffold399803:755798..755822 21/25 unknown
Scaffold41413:115942..115966 21/25 unknown
Scaffold4653:474..498 21/25 unknown
Scaffold48253:4083300..4083324 21/25 unknown
Scaffold57180:4039157..4039181 21/25 Sense off-target Xelaev16062866m
Scaffold5732:5204461..5204485 21/25 unknown
Scaffold63404:4279242..4279266 21/25 unknown
Scaffold69443:3402087..3402111 21/25 unknown
Scaffold70222:765121..765145 21/25 unknown
Scaffold7555:2159003..2159027 21/25 unknown
Scaffold78860:3811433..3811457 21/25 unknown
Scaffold8129:7870652..7870676 21/25 Antisense off-target Xelaev16074776m
Scaffold86067:663004..663028 21/25 unknown
Scaffold97703:3116162..3116186 21/25 unknown
Scaffold99286:85720..85744 21/25 unknown
Scaffold9994:8011913..8011937 21/25 Sense off-target Xelaev16081433m
tropicalis 7.1 scaffold_3:35598535..35598559 22/25 Antisense off-target dnaaf4
scaffold_3:26458908..26458932 21/25 unknown
Publications
First: Role of the TAK1-NLK-STAT3 pathway in TGF-beta-mediated mesoderm induction. [Genes Dev 2004]
Most recent: TAK1 promotes BMP4/Smad1 signaling via inhibition of erk MAPK: a new link in the FGF/BMP regulatory network. [Differentiation 2012]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.0
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556