Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249870

Morpholino Name: map3k7 MO1
Synonyms: tak1 MO, xTAK1
Target mRNA: map3k7

Morpholino Type: uncategorized morpholino
Sequence: 5' TCATTTCAGCAGAGGTGGCAGACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25
genomic

MO
5' ATGTCTGCCACCTCTGCTGAAATGA 3' ||||||||||||||||||||||||| 3' TACAGACGGTGGAGACGACTTTACT 5' 5' ATGTCTGCCACTTCTGCTGACATGA 3' ||||||||||| |||||||| |||| 3' TACAGACGGTGGAGACGACTTTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:86331857..86331881 25/25 Antisense target map3k7.L
chr5S:67867311..67867335 23/25 Antisense target map3k7.S
chr2S:145853160..145853184 22/25 Sense off-target cntn5.S
chr3S:105489596..105489620 22/25 Sense off-target sh3rf2.S
chr7S:74890435..74890459 22/25 Sense off-target grik5.S
chr6S:75066687..75066711 22/25 Antisense off-target ripor2.S
chr2L:122313716..122313740 21/25 Sense off-target LOC108708487 [provisional:gpc6]
chr2S:120308353..120308377 21/25 Antisense off-target erbb3.S
chr3S:114955041..114955065 21/25 Sense off-target Xelaev18021538m
chr3S:115368507..115368531 21/25 Antisense off-target pcdh1.S
chr3S:37622438..37622462 21/25 Antisense off-target adamts17.S
chr3S:54005551..54005575 21/25 Sense off-target bmp7.2.S
chr5L:154012723..154012747 21/25 Sense off-target efr3b.L
chr5S:42107820..42107844 21/25 Sense off-target thbs2.S
chr3L:70242179..70242203 21/25 Antisense off-target cacna2d1.L
chr3S:110274832..110274856 21/25 Antisense off-target tenm3.S
chr8L:111618654..111618678 21/25 Sense off-target Xelaev18040617m
chr9_10L:95803835..95803859 21/25 Sense off-target tmem184a.L
chr6S:67441892..67441916 21/25 Sense off-target pign.S
Scaffold83663:214..238 22/25 unknown
chr5L:149886004..149886028 22/25 unknown
chr7L:49893643..49893667 22/25 unknown
Scaffold106493:90..114 21/25 unknown
Scaffold110366:100..124 21/25 unknown
Scaffold19:118230..118254 21/25 unknown
Scaffold24305:229..253 21/25 unknown
Scaffold39516:474..498 21/25 unknown
chr1L:9557330..9557354 21/25 unknown
chr1S:129227583..129227607 21/25 unknown
chr1S:26062209..26062233 21/25 unknown
chr1S:42826657..42826681 21/25 unknown
chr2L:141275334..141275358 21/25 unknown
chr2L:163922240..163922264 21/25 unknown
chr2L:166528137..166528161 21/25 unknown
chr2L:44063395..44063419 21/25 unknown
chr2L:7724699..7724723 21/25 unknown
chr2L:80899423..80899447 21/25 unknown
chr2S:105263058..105263082 21/25 unknown
chr2S:110587552..110587576 21/25 unknown
chr2S:112528013..112528037 21/25 unknown
Scaffold73016:87..111 21/25 unknown
Scaffold83:494822..494846 21/25 unknown
Scaffold85964:75..99 21/25 unknown
chr1L:136526449..136526473 21/25 unknown
chr3S:116994392..116994416 21/25 unknown
chr4S:120855395..120855419 21/25 unknown
chr4S:68505975..68505999 21/25 unknown
chr5L:62765294..62765318 21/25 unknown
chr5S:285600..285624 21/25 unknown
chr6S:113570575..113570599 21/25 unknown
chr2S:127071575..127071599 21/25 unknown
chr8L:105703441..105703465 21/25 unknown
chr6S:116109959..116109983 21/25 unknown
chr6S:78912702..78912726 21/25 unknown
chr7L:21363127..21363151 21/25 unknown
tropicalis 10.0 Chr3:100692429..100692453 22/25 Antisense off-target dnaaf4
Chr3:110203236..110203260 21/25 unknown
Publications
First: Role of the TAK1-NLK-STAT3 pathway in TGF-beta-mediated mesoderm induction., Genes Dev 2004  
Most recent: TAK1 promotes BMP4/Smad1 signaling via inhibition of erk MAPK: a new link in the FGF/BMP regulatory network., Differentiation 2012                    
View All Papers