Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249871

Morpholino Name: mapk11 MO1
Synonyms: xp38 beta-MO
mRNA Target: mapk11

Morpholino Type:
Sequence:
5' CGCCCGCTCATCTTGCCCCGACCGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' CCGGTCCGGACAAGATGAGCGGGCG 3' |||||| || ||||||||||||||| 3' GGCCAGCCCCGTTCTACTCGCCCGC 5' 5' CAGGTCCGGACAAGATGAGCGGGCG 3' | |||| || ||||||||||||||| 3' GGCCAGCCCCGTTCTACTCGCCCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold26505:3039271-3039295 25/25 Antisense off-target Xelaev16035582m
Scaffold152894:556325-556349 22/25 Antisense target mapk11.S
Scaffold19259:1272809-1272833 22/25 Sense off-target Xelaev16024347m
Scaffold39723:7341000-7341024 22/25 unknown
Scaffold7281:2780030-2780054 22/25 Sense off-target Xelaev16070425m
Scaffold34423:4274496-4274520 21/25 unknown
Scaffold377:2120041-2120065 21/25 unknown
Scaffold43242:589564-589588 21/25 Sense off-target Xelaev16053286m
tropicalis 7.1 scaffold_3:100037660-100037684 23/25 Antisense target mapk11
scaffold_7:93672523-93672547 21/25 Sense off-target rnf207
scaffold_7:93675604-93675628 21/25 Antisense off-target rnf207
Publications
First: Nemo-like kinase, an essential effector of anterior formation, functions downstream of p38 mitogen-activated protein kinase. [Mol Cell Biol 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556