Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249871

Morpholino Name: mapk11 MO1
Synonyms: xp38 beta-MO
Target mRNA: mapk11

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCCCGCTCATCTTGCCCCGACCGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genomic

MO
5' CCGGTCCGGACAAGATGAGCGGGCG 3' |||||| || ||||||||||||||| 3' GGCCAGCCCCGTTCTACTCGCCCGC 5' 5' CCGGTCGGGGCAAGATGAGCGGGCG 3' ||||||||||||||||||||||||| 3' GGCCAGCCCCGTTCTACTCGCCCGC 5' 5' CAGGTCCGGACAAGATGAGCGGGCG 3' | |||| || ||||||||||||||| 3' GGCCAGCCCCGTTCTACTCGCCCGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:62734233..62734257 25/25 Antisense target mapk11.L
chr3S:75822474..75822498 22/25 Antisense target mapk11.S
chr4S:104749952..104749976 22/25 Sense off-target tmcc1.S
chr5L:93247754..93247778 22/25 Sense off-target LOC108716183 [provisional:adgrb3]
chr5S:39293389..39293413 21/25 Antisense off-target LOC108717831 [provisional:crim1]
chr9_10L:71270289..71270313 21/25 Sense off-target slc19a1.L
chr8L:59244248..59244272 22/25 unknown
chr1S:67233504..67233528 21/25 unknown
tropicalis 10.0 Chr3:71550630..71550654 23/25 Antisense target mapk11
Chr7:98725571..98725595 21/25 Sense off-target rnf207
Chr7:98728648..98728672 21/25 Antisense off-target rnf207
Publications
First: Nemo-like kinase, an essential effector of anterior formation, functions downstream of p38 mitogen-activated protein kinase., Mol Cell Biol 2010    
Most recent:
View All Papers