Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249872

Morpholino Name: mapk14 MO1
Synonyms: Xp38, Xp38a, Xp38alpha AMO, xp38 alpha-MO
mRNA Target: mapk14

Morpholino Type: uncategorized morpholino
Sequence:
5' GACGTAAGATTGATTGGATGACATA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATGTCATCCAATCAATCTTACGTC 3' |||||||||||||||||||||||| 3' ATACAGTAGGTTAGTTAGAATGCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold196263:31983..32007 25/25 Antisense off-target Xelaev16024865m
Scaffold39730:1262033..1262057 21/25 Sense off-target Xelaev16051088m
tropicalis 7.1 scaffold_1:71696740..71696764 24/25 Antisense target mapk14
Publications
First: p38 MAP kinase regulates the expression of XMyf5 and affects distinct myogenic programs during Xenopus development., Dev Biol 2005                
Most recent: Nemo-like kinase, an essential effector of anterior formation, functions downstream of p38 mitogen-activated protein kinase., Mol Cell Biol 2010    
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556