Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249872

Morpholino Name: mapk14 MO1
Synonyms: Xp38, Xp38a, Xp38alpha AMO, xp38 alpha-MO
Target mRNA: mapk14

Morpholino Type: uncategorized morpholino
Sequence: 5' GACGTAAGATTGATTGGATGACATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CATGTCATCCAATCAATCTTACGTC 3' |||||||||||||||||||||||| 3' ATACAGTAGGTTAGTTAGAATGCAG 5' 5' TATGTCATCCAATCAATCTTACGTC 3' ||||||||||||||||||||||||| 3' ATACAGTAGGTTAGTTAGAATGCAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:55222655..55222679 25/25 Antisense target mapk14.S
chr4L:42466005..42466029 21/25 Sense off-target bco1.L
tropicalis 10.0 Chr2:69942409..69942433 24/25 Antisense target mapk14
Publications
First: p38 MAP kinase regulates the expression of XMyf5 and affects distinct myogenic programs during Xenopus development., Dev Biol 2005                
Most recent: Nemo-like kinase, an essential effector of anterior formation, functions downstream of p38 mitogen-activated protein kinase., Mol Cell Biol 2010    
View All Papers