Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249873

Morpholino Name: mapk7 MO1
Synonyms: ERK5 MO
mRNA Target: mapk7

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGCTCCTTCCTTGGCTCCGCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGCGGAGCCAAGGAAAGAGCCAG 3' ||||||||||||||||| |||| || 3' TACCGCCTCGGTTCCTTCCTCGTTC 5' 5' ATGGCGGAGCCAAGGAAGGAGCAAG 3' ||||||||||||||||||||||||| 3' TACCGCCTCGGTTCCTTCCTCGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold106892:1069302..1069326 25/25 Antisense target mapk7.L
tropicalis 7.1 scaffold_9:98239903..98239927 23/25 Antisense target mapk7
scaffold_8:12253030..12253054 22/25 unknown
scaffold_1:185445556..185445580 21/25 unknown
scaffold_2:146354081..146354105 21/25 unknown
scaffold_2:47244878..47244902 21/25 Antisense off-target frmpd4
Publications
First: Requirement of the MEK5-ERK5 pathway for neural differentiation in Xenopus embryonic development., EMBO Rep 2005  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556