Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249873

Morpholino Name: mapk7 MO1
Synonyms: ERK5 MO
Target mRNA: mapk7

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCTCCTTCCTTGGCTCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' ATGGCGGAGCCAAGGAAAGAGCCAG 3' ||||||||||||||||| |||| || 3' TACCGCCTCGGTTCCTTCCTCGTTC 5' 5' ATGGCGGAGCCAAGGAAGGAGCAAG 3' ||||||||||||||||||||||||| 3' TACCGCCTCGGTTCCTTCCTCGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold22:4610516..4610540 25/25 Antisense target mapk7.L
tropicalis 10.0 Chr9:7124725..7124749 23/25 Antisense target mapk7
Chr8:33611662..33611686 22/25 Antisense off-target astn2
Chr1:38376782..38376806 21/25 Antisense off-target gabrb1
Chr2:106184696..106184720 21/25 Antisense off-target frmpd4
Chr2:6500189..6500213 21/25 Sense off-target arhgap31
Publications
First: Requirement of the MEK5-ERK5 pathway for neural differentiation in Xenopus embryonic development., EMBO Rep 2005  
Most recent:
View All Papers