Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249874

Morpholino Name: mapk8 MO1
Synonyms: JNK MO, JNK1, Xdsh-MO, xJNK
mRNA Target: mapk8

Morpholino Type: uncategorized morpholino
Sequence:
5' TGCTGTCACGCTTGCTTCGGCTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGAGCCGAAGCAAGCGTGACAGCA 3' ||||||||||||||||||||||||| 3' TACTCGGCTTCGTTCGCACTGTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold11978:140839..140863 25/25 unknown
Scaffold27067:2391605..2391629 25/25 Antisense target mapk8.L
tropicalis 7.1 scaffold_7:19430418..19430442 25/25 Antisense off-target mapk10
Publications
First: JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates., EMBO Rep 2002  
Most recent: Role of JNK during buccopharyngeal membrane perforation, the last step of embryonic mouth formation., Dev Dyn 2017              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556