Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249874

Morpholino Name: mapk8 MO1
Synonyms: JNK MO, JNK1, Xdsh-MO, xJNK
Target mRNA: mapk8

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCTGTCACGCTTGCTTCGGCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGAGCCGAAGCAAGCGTGACAGCA 3' ||||||||||||||||||||||||| 3' TACTCGGCTTCGTTCGCACTGTCGT 5' 5' ATGAGCCGAAGCAAGCGTGACAGCA 3' ||||||||||||||||||||||||| 3' TACTCGGCTTCGTTCGCACTGTCGT 5' 5' ATGAGCCGAAGCAAGCGTGACAGCA 3' ||||||||||||||||||||||||| 3' TACTCGGCTTCGTTCGCACTGTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7L:56496417..56496441 25/25 Antisense target mapk8.L
chr7S:37392103..37392127 25/25 Antisense target mapk8.S
tropicalis 10.0 Chr7:61782920..61782944 25/25 Antisense target mapk8
Publications
First: JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates., EMBO Rep 2002  
Most recent: Role of JNK during buccopharyngeal membrane perforation, the last step of embryonic mouth formation., Dev Dyn 2017              
View All Papers