Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249875

Morpholino Name: mapt MO1
Synonyms: tau
Target mRNA: mapt

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTCCTAACGGTGCTGCCCGGTGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24 23/24
genomic

MO
5' ACACCGGGCAGCACCGTTAGGACT 3' |||||||||||||||||||||||| 3' TGTGGCCCGTCGTGGCAATCCTGA 5' 5' ACACCGGGCAGCACCGTTAGGACT 3' |||||||||||||||||||||||| 3' TGTGGCCCGTCGTGGCAATCCTGA 5' 5' ATACCGGGCAGCACCGTTAGGACT 3' | |||||||||||||||||||||| 3' TGTGGCCCGTCGTGGCAATCCTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:6152784..6152807 24/24 Antisense target mapt.L
chr9_10S:5606483..5606506 23/24 Antisense target mapt.S
chr9_10L:6152784..6152807 24/24 Sense off-target Xelaev18043332m
tropicalis 10.0 Chr10:17220602..17220625 24/24 Antisense target mapt
Publications
First: hnRNP K post-transcriptionally co-regulates multiple cytoskeletal genes needed for axonogenesis., Development 2011                  
Most recent:
View All Papers