Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249876

Morpholino Name: marcks MO1
Synonyms: MARCKS MO
Target mRNA: marcks

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCTTGGAGAATTGGGCTCCCATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' AATGGGAGCCCAATTCTCCAAGACC 3' ||||||||||||||||||||||||| 3' TTACCCTCGGGTTAAGAGGTTCTGG 5' 5' AATGGGAGCCCAATTCTCCAAGACC 3' ||||||||||||||||||||||||| 3' TTACCCTCGGGTTAAGAGGTTCTGG 5' 5' AATGGGAGCCCAATTCTCCAAGACC 3' ||||||||||||||||||||||||| 3' TTACCCTCGGGTTAAGAGGTTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:77043616..77043640 25/25 Antisense target marcks.L
chr5S:58489987..58490011 25/25 Antisense target marcks.S
tropicalis 10.0 Chr5:75906988..75907012 25/25 Antisense target marcks
Publications
First: Essential role of MARCKS in cortical actin dynamics during gastrulation movements., J Cell Biol 2004          
Most recent:
View All Papers