Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249877

Morpholino Name: marcksl1 MO1
Synonyms: XMLP
Target mRNA: marcksl1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACTCTACGCTACCCATTGTGACT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AGTCACAATGGGTAGCGTAGAGTCC 3' ||||||||||||||||||||||||| 3' TCAGTGTTACCCATCGCATCTCAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2S:70632862..70632886 25/25 Antisense target marcksl1.S
Publications
First: Isolation and characterization of a Xenopus gene (XMLP) encoding a MARCKS-like protein., Int J Dev Biol 2001                          
Most recent:
View All Papers