Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249878

Morpholino Name: marcksl1 MO2
Synonyms: 6A5moA
Target mRNA: marcksl1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTCTATACTACCCATCGTCTGCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGGCAGACGATGGGTAGTATAGAGT 3' ||||||||||||||||||||||||| 3' CCCGTCTGCTACCCATCATATCTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:38829675..38829699 21/25 unknown
tropicalis 10.0 Chr2:86413249..86413273 25/25 Antisense target marcksl1
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers