Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249879

Morpholino Name: mark2 MO1
Synonyms: PAR-1 MO, PAR-1 morpholino, PAR-1BY, PAR-1BY MO, PAR1B MO, PAR1BY MO, Par1, xPar-1 MO
mRNA Target: mark2

Morpholino Type: uncategorized morpholino
Sequence:
5' TCGGCAGCGGTGTCCTGGTGGTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold2589:1127444..1127468 25/25 unknown
tropicalis 7.1 scaffold_54:183170..183194 24/25 unknown
Publications
First: The polarity-inducing kinase Par-1 controls Xenopus gastrulation in cooperation with 14-3-3 and aPKC., EMBO J 2004  
Most recent: Signaling crosstalk between TGFβ and Dishevelled/Par1b., Cell Death Differ 2012                      
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556