Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249879

Morpholino Name: mark2 MO1
Synonyms: PAR-1 MO, PAR-1 morpholino, PAR-1BY, PAR-1BY MO, PAR1B MO, PAR1BY MO, Par1, xPar-1 MO
Target mRNA: mark2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGGCAGCGGTGTCCTGGTGGTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGACCACCAGGACTCCGCTGCCGA 3' |||||||||||||| |||||||||| 3' TACTGGTGGTCCTGTGGCGACGGCT 5' 5' ATGACCACCAGGACACCGCTGCCGA 3' ||||||||||||||||||||||||| 3' TACTGGTGGTCCTGTGGCGACGGCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:25826022..25826046 25/25 Antisense target mark2.L
tropicalis 10.0 Chr4:36227614..36227638 24/25 Antisense target mark2
Publications
First: The polarity-inducing kinase Par-1 controls Xenopus gastrulation in cooperation with 14-3-3 and aPKC., EMBO J 2004  
Most recent: Signaling crosstalk between TGFβ and Dishevelled/Par1b., Cell Death Differ 2012                      
View All Papers