Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249880

Morpholino Name: mark2 MO2
Synonyms: Par-1 MO2
Target mRNA: mark2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCATCCCGATACTGAAATTACCAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GTTGGTAATTTCAGTATCGGGATGA 3' ||||||||||||||||||||||||| 3' CAACCATTAAAGTCATAGCCCTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:25826074..25826098 25/25 Antisense target mark2.L
Publications
First: Neural crest specification by noncanonical Wnt signaling and PAR-1., Development 2011                          
Most recent:
View All Papers