Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249881

Morpholino Name: mark2 MO3
Synonyms: PAR-1BX MO, PAR1BX MO, Par1bx
mRNA Target: mark2

Morpholino Type: uncategorized morpholino
Sequence:
5' CCAAAAAGCAGGTCCCTCTCATGTA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TACATGAGAGGGACCTGCTTTTCGG 3' |||||||||||||||||||||| || 3' ATGTACTCTCCCTGGACGAAAAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold31469:1861542..1861566 25/25 Antisense off-target Xelaev16042174m
Scaffold2589:1148973..1148997 24/25 Antisense off-target Xelaev16034955m
Scaffold83106:2067688..2067712 21/25 unknown
tropicalis 7.1 scaffold_54:207166..207190 24/25 Antisense target mark2
scaffold_3:26774766..26774790 21/25 unknown
Publications
First: Distinct PAR-1 proteins function in different branches of Wnt signaling during vertebrate development., Dev Cell 2005      
Most recent: Signaling crosstalk between TGFβ and Dishevelled/Par1b., Cell Death Differ 2012                      
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556