Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249881

Morpholino Name: mark2 MO3
Synonyms: PAR-1BX MO, PAR1BX MO, Par1bx
Target mRNA: mark2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAAAAAGCAGGTCCCTCTCATGTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genomic

MO
5' TACATGAGAGGGACCTGCTTTTCGG 3' |||||||||||||||||||||| || 3' ATGTACTCTCCCTGGACGAAAAACC 5' 5' TACATGAGAGGGACCTGCTTTTCGG 3' |||||||||||||||||||||| || 3' ATGTACTCTCCCTGGACGAAAAACC 5' 5' TACATGAGAGGGACCTGCTTTTTGG 3' ||||||||||||||||||||||||| 3' ATGTACTCTCCCTGGACGAAAAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:1856278..1856302 25/25 Antisense target mark2.S
chr4L:25804493..25804517 24/25 Antisense target mark2.L
chr7L:67863698..67863722 21/25 unknown
tropicalis 10.0 Chr4:36203621..36203645 24/25 Antisense target mark2
Chr3:110548978..110549002 21/25 unknown
Publications
First: Distinct PAR-1 proteins function in different branches of Wnt signaling during vertebrate development., Dev Cell 2005      
Most recent: Signaling crosstalk between TGFβ and Dishevelled/Par1b., Cell Death Differ 2012                      
View All Papers