Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17249882

Morpholino Name: mark3 MO1
Synonyms: PAR-1A MO
Target mRNA: mark3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCCCCTCGTGCAAGAACCCTATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' AATAGGGTTCTTGCACGAGGGGACC 3' ||||||||||||||||||||||||| 3' TTATCCCAAGAACGTGCTCCCCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:74747020..74747044 25/25 Antisense target mark3.L
Publications
First: Distinct PAR-1 proteins function in different branches of Wnt signaling during vertebrate development., Dev Cell 2005      
Most recent:
View All Papers